Context Matters — the Epigenetics Revolution

Stephen L. Talbott

From In Context #23 (Spring, 2010)

Following are three excerpts from a series of lengthy articles entitled “On Making the Genome Whole.” The excerpts are intended to provide an introduction to the new molecular biological researches that are causing a thorough implosion of the old, gene-centered understanding of the organism. References have been removed from the text here and may be found in the original articles, as indicated in the note at the end.

I. Lusting for a Code

When it emerged a few years ago that humans and chimpanzees shared, by some measures, 98 or 99 percent of their DNA, a good deal of verbal hand-wringing and chest-beating ensued. How could we hold our heads up with high-browed, post-simian dignity when, as the New Scientist reported, “chimps are human”? If the DNA of the two species is more or less the same, and if, as nearly everyone seemed to believe, DNA is destiny, what remained to make us special?

Such was the fretting on the human side, anyway. To be truthful, the chimps didn’t seem much interested. And their disinterest, it turns out, was far more fitting than our angst.

In 1992 Nobel prizewinning geneticist Walter Gilbert wrote that you and I will hold up a CD containing our DNA sequence and say, “Here is a human being; it’s me!” His essay was entitled, “A Vision of the Grail.” Today one can only wonder how we became so invested in the almost sacred importance of an abstract and one-dimensional genetic code — a code so thinly connected to the full-fleshed reality of ourselves that its entire import could be captured in a naked and scarcely coherent string of four endlessly repeating letters, like so:

ATGCGATCTGTGAGCCGAGTCTTTAAGTTC

It’s true that the code, as it was understood at the height of the genomic era, had some grounding in material reality. Each of the four different letters represented one of the four nucleotide bases constituting the DNA sequence. And each group of three successive letters (referred to as a codon) potentially represented an amino acid, a constituent of protein. The idea was that the bases in a protein-coding DNA sequence, or gene, led to the synthesis of the corresponding sequence of amino acids in a protein. And proteins play a decisive role in virtually all living processes. By specifying the production of proteins, genes were presumed bearers of the blueprint, or master program, or molecular instruction book of our lives.

Certainly the idea seemed powerful to those who were enamored of it. In their enthusiasm they gave us countless cellular mechanisms and one revolutionary gene discovery after another — a gene for cancer, a gene for cystic fibrosis (excerpted above), a gene for obesity, a gene for depression, a gene for alcoholism, a gene for sexual preference . . . . Building block by building block, genetics was going to show how a healthy human being could be constructed from mindless, indifferent matter.

And yet the most striking thing about the genomic revolution is that the revolution never happened. Yes, it’s been an era of the most amazing technical achievement, marked by an overwhelming flood of new data. Supposed new molecular mechanisms are being detailed weekly. But one might easily think that the meaning of it all — how we can understand the integrity and unified functioning of the living cell — has been more obscured than illumined by the torrent of data. It’s true that we are gaining, even if largely by trial and error, certain manipulative powers. But what about our clouded vision of the Grail? “Many of us in the genetics community,” write Linda and Edward McCabe, authors of DNA: Promise and Peril, “sincerely believed that DNA analysis would provide us with a molecular crystal ball that would allow us to know quite accurately the clinical futures of our individual patients.” Unfortunately, as they and many others now acknowledge, the reality did not prove so straightforward.

As minor tokens of the changing consciousness among biologists, one could cite articles from this past year in the world’s two premier scientific journals, each reflecting upon the discovery of the “gene for cystic fibrosis.” The Promis of a Cure: 20 Years and Counting — so ran the headline in Science, followed by this slightly sarcastic gloss: “The discovery of the cystic fibrosis gene brought big hopes for gene-based medicine; although a lot has been achieved over two decades, the payoff remains just around the corner.” An echo quickly came from Nature, without the sarcasm:

One Gene, Twenty Years — “When the cystic fibrosis gene was found in 1989, therapy seemed around the corner. Two decades on, biologists still have a long way to go.”

The story has been repeated for one gene after another, which may be part of the reason why molecular biologist Tom Misteli offered such a startling postscript to the unbounded optimism of the Human Genome Project. “Comparative genome analysis and large-scale mapping of genome features,” he wrote in the journal Cell, “shed little light onto the Holy Grail of genome biology, namely the question of how genomes actually work” in living organisms.

But is this surprising? The human body is not a mere implication of clean logical code in abstract conceptual space, but rather a play of complexly shaped and intricately interacting substances and forces. Yet the four genetic letters, in the researcher’s mind, became curiously detached from their material matrix, with its complexities of resistant form and muscular action. Given the way many discussions were pursued, it hardly would have mattered whether the letters of the “Book of Life” represented nucleotide bases or completely different molecular combinations. All that counted were certain logical correspondences between code and protein together with a few bits of regulatory logic — all buttressed, to be sure, by the massive weight of an unsupported assumption: somehow, by neatly executing our dematerialized formulation of its supposedly computer-like DNA logic, the organism would fulfill its destiny as a living creature. The details could be worked out later. That the enlivened physical being of the gene and chromosome must have more to contend with, and more to contribute, than obedience to a one-dimensional code marking out an immaculate causal connection linking DNA and protein — this certainty didn’t seem to burden many geneticists unduly.

The misdirection in all this badly needs elaborating — a task I hope to advance here. As for the differences between humans and chimpanzees, the only wonder is that so many were exercised by it. If we had wanted to compare ourselves to chimps, we could have done the obvious and direct and scientifically respectable thing: we could have observed ourselves and chimps, noting the similarities and differences. Not such a strange notion, really — unless one is so transfixed by a code abstracted from human and chimp that one comes to prefer it to the organisms themselves — the organisms that are the only possible source for whatever legitimacy and physical meaning the abstraction possesses.

I’m not aware of any pundit who, brought back to reality from the realm of code-fixated cerebration, would have been so confused about the genetic comparison as to invite a chimp home for dinner to discuss world politics. If we had been looking to ground our levitated theory in scientific observation, we would have known that the proper response to the code similarity in humans and chimps was: “Well, so much for the central, determining role we’ve been assigning to our genes.”

Thankfully, that seems to be where biology is getting to these days. We are progressing into a post-genomic era — often referred to as the era of epigenetics.

II. Reckoning with the Environment

“Epigenetics” most commonly refers to heritable changes in gene activity associated with factors other than the actual DNA sequence of the genes. But in order to understand the important developments now under way in biology, it’s more useful to take “epigenetics” in its broadest sense as “putting the gene in its living context”.

In the mammalian genome chromosomes normally come in pairs, one inherited from the mother and the other from the father. Any given gene occurs twice, with one version (“allele”) located on the first chromosome of a pair and the other on the second. When the two alleles are identical, the organism is said to be homozygous for that gene; when the alleles are different, the organism is heterozygous. For example, there are mice that, in their natural (“wildtype”) state, are dark-colored — a color that is partly dependent on a gene known as Kit. The mice are normally homozygous for this gene. When, however, one of the Kit alleles is replaced with a certain mutant gene, the now heterozygous mouse shows white feet and a white tail tip.

That result was perfectly natural (if you call such artificial gene manipulations “natural”). But it is also where the story becomes interesting. Scientists at the University of Nice- Sophia Antipolis in France took some of the mutant, white-spotted mice and bred them together. In the normal course of things, some of the offspring were again wildtype homozygous animals — neither of their Kit alleles was mutant. However, to the researchers’ surprise, these “normal,” wildtype offspring maintained, to a variable extent, the same white spots characteristic of the mutants. It was an apparent violation of Mendel's law of inheritance: while the genes themselves were sorted between generations properly, their effects did not follow the “rules.” A trait was displayed despite the absence of its corresponding gene. Apparently something in addition to the genes themselves — something epigenetic — figured in the inheritance of the mice off- spring, producing the distinctive coloration.

Another group of researchers, led by Michael Skinner at the University of Washington, looked at the effects of the fungicide vinclozolin on laboratory rats. Banned in Scandinavia and Europe but allowed on some crops in the U.S., vinclozolin is an endocrine-disrupting chemical. If pregnant female rats are exposed to it while their embryos are under-going sexual organ differentiation, the male offspring develop serious problems as adults — death of sperm-generating cells, lowered sperm count and motility and, later, immune abnormalities and various diseases including cancer. The remarkable thing is that the effects, which were not rooted in changes to the DNA sequence, were found to be transmitted over four generations without weakening. That is, acquired characteristics — deficiencies in embryos brought on by fungicide exposure — were inherited by off-spring who were not subject to the same exposure. This led Skinner to ask a troubling question:

“How much of the disease we see in our society today is transgenerational and more due to exposures early in life than anything else?”

The whole business looks rather like vindication for the long-dismissed Lamarckian doctrine of the inheritance of acquired characteristics, a doctrine that has indeed been making a comeback of late. But inheritance aside, puzzling results such as these put the question, “Are genes equivalent to destiny?” in a new light. In 2007 a team of researchers at Duke University reported that exposure of pregnant mice to bisphenol A (a chemical used in many common plastics such as baby bottles and dental composites) “is associated [in the offspring], with higher body weight, increased breast and prostate cancer, and altered reproductive function.” The exposure also shifted the coat color of the mice toward yellow — a change again found to be transmitted across generations despite its not being linked to a gene mutation. But more to the present point: the changes brought on by the chemical were negated when the researchers supplemented the maternal diet with folic acid, a B vitamin.

And so the “epigenome” — everything in the cell that bears on gene expression — responds to healthy as well as unhealthy influences. As another illustration of this: researchers at McGill University in Montreal looked at the consequences of two kinds of maternal behavior in rats. Some mother rats patiently lick and groom their newborns, while others generally neglect their pups. The difference turns out to be reflected in the lives of the offspring: those who are licked grow up (by the usual measures) to be relatively confident and content, whereas the neglected ones show depression-like symptoms and tend to be fearful when placed in new situations.

This difference is correlated with different levels of activity in particular genes in the hippocampus of the rats’ brains. Not that the genes themselves are changed; the researchers found instead that various epigenetic modifications of the hippocampus alter the way the genes work. Other investigations have pointed toward similar changes in the brains of human suicide victims who were abused as children.

Perhaps even more surprisingly, mouse embryos grown by means of in vitro fertilization (IVF) — spending their first several days in a petri dish — showed epigenetic changes resulting in altered gene activity. And now there are reports that humans conceived through IVF have an increased risk of several birth defects. The main suspect is again the epigenome.

III. Paradoxes 

To realize the full significance of the truth so often remarked in the technical literature today — namely, that context matters — is indeed to embark upon a revolutionary adventure. It means reversing one of the most deeply engrained habits within science — the habit of explaining the whole as the result of its parts. If an organic context really does rule its parts in the way molecular biologists are beginning to recognize, then we have to learn to speak about that peculiar form of governance, turning our usual causal explanations upside down. We have to learn to explain the part as an expression of a larger, contextual unity.

Historically, an intellectual recoiling from this necessity was what led to an overly narrow concept of the genetic code. The code was supposed to reassure us that something like a computational machine lay beneath the life of the organism. The fixity, precision, and unambiguous logical relations of the code seemed to guarantee its strictly mechanistic performance in the cell. Yet it is this fixity, this notion of a precisely characterizable march from cause to effect — from gene to trait — that has lately been dissolving more and more into the fluid, dynamic exchange of living processes. Organisms, it appears, must be understood and explained at least in part from above downward, from context to subcontext, from the general laws or character of their being to the never fully independent details. In the end, we can meaningfully apprehend the lowest-level activities only so far as we recognize them to be performances of the whole organism.

A number of apparent paradoxes helped to nudge the molecular biologist toward a more contextualized understanding of the gene. To begin with, the Human Genome Project revised the human gene count downward from 100,000 to somewhere between 20-25,000. What made the figure startling was the fact that much simpler creatures — for example, a tiny, transparent roundworm — were found to have roughly the same number of genes. More recently researchers have turned up a pea aphid with 34,600 genes and a water flea with 39,000 genes. If genes account for our complexity and make us what we are — well, not even the “chimps are human” advocates were ready to set themselves on the same scale with a water flea. The difference in gene counts required some sort of shift in our understanding.

A second oddity centered on the fact that, upon “deciphering” the Book of Life, we found that our coding scheme made the vast bulk of it read like nonsense. That is, some 95 or 98 percent of human DNA was not a carrier of the genetic code at all. It was useless for making proteins. Most of this noncoding DNA was at first dismissed as “junk” — meaningless evolutionary detritus accumulated over the ages. At best it was viewed as a kind of bag of spare parts, borne by cells from one generation to another for possible employment in future genomic innovations. But that’s an awful amount of junk for a cell to have to lug around, duplicate at every cell division, and otherwise manage on a continuing basis.

Another paradox — perhaps the most decisive one — was recognized and wrestled with (and more often just ignored) going back to the early twentieth century. With few exceptions, every different type of cell in the human body contains the same chromosomes and the same DNA sequence as the original, single-celled zygote. Yet somehow this zygote manages to differentiate into every manner of tissue — liver, skin, muscle, brain, blood, bone, retina . . . . If genes determine the form and substance of the organism, how is it that such radically different cellular architectures result from the same genes? What directs genes in their temporally and spatially varying activity so as to produce the intricately sculpted and complexly differentiated form of a human being? And how can this directing agency be governed by the very genes it directs?

The developmental biologist F. R. Lillie, remarking in 1927 on the contrast between “genes which remain the same throughout life” and a developmental process that “never stands still from germ to old age,” asserted that “Those who desire to make genetics the basis of physiology of development will have to explain how an unchanging complex can direct the course of an ordered developmental stream.”

Think for a moment about this ordered developmental stream. When a cell of the body divides, the daughter cells can be thought of as “inheriting” traits from the parent cell. The puzzle about this cellular-level inheritance is that, especially during the main period of an organism’s development, it leads to a dramatic, highly directed differentiation of tissues. For example, embryonic cells on a path leading to heart muscle tissue become progressively more specialized. The changes each step of the way are “remembered” (that is, inherited) — but what is remembered is caught up within a process of continuous change. You cannot say that “every cell reproduces after its own likeness.”

Over successive generations, cells destined to become a particular type lose their ability to be transformed into any other tissue type. And so the path of differentiation leads from totipotency (the single-celled zygote is capable of developing into every cell of the body), to pluripotency (embryonic stem cells can transform themselves into many, but not all, tissue types during fetal development), to multipotency (blood stem cells can yield red cells, white cells, and platelets), to the final, fully differentiated cell of a particular tissue. In tissues where cell division continues further, the inheritance thereafter may take on a much greater constancy, with like giving rise (at least approximately) to like.

Cells of the mature heart and brain, then, have inherited entirely different destinies, but the difference in those destinies was not written in their DNA sequences, which remain identical in both organs. If we were stuck in the “chimp equals human” mindset, we would have to say that the brain is the same as the heart.

So what’s going on? The paradoxes mentioned above turn out to be intimately related. One strong hint pointing toward their resolution lay in the fact that, as organisms rise on the evolutionary scale, they tend to have more “junk DNA.” Noncoding DNA accounts for some 10% of the genome in many one-celled organisms, 75% in roundworms, and 98% in humans. The ironic suspicion quickly became too obvious to ignore: maybe it’s precisely our “junk” that differentiates us from water fleas. Maybe what counts most is not so much the genes themselves as the way they are regulated by the larger context. Noncoding DNA could provide the complex regulatory functions that direct genes toward service of the organism’s needs.

That suspicion has now become standard doctrine — a still much-too-simplistic doctrine, if one stops there, however. For noncoding as well as coding DNA sequences continue unchanged throughout the organism’s entire trajectory of differentiation, from single cell to maturity. Lillie’s point therefore remains: it is hardly possible for an unchanging complex to explain an ordered developmental stream. Things cannot by themselves explain processes.

We need a more living understanding. It is not only that noncoding DNA is by itself inadequate to regulate genes. What we are finding is that at the molecular level the organism is so dynamic, so densely woven and multidirectional in its causes and effects, that it cannot be explicated as living process through any strictly local investigations. When it begins to appear that “everything does everything to everything,” as one pair of researchers put it in the journal Cellular Signalling, the search for “regulatory control” necessarily leads to the unified and irreducible functioning of the cell and organism as a whole.

Concluding Remarks

The actual epigenetic discoveries of the past decade or so, many of which are reviewed in the full-length articles from which the foregoing excerpts were lifted, are far too complex to try to summarize in a brief space. In fact, complexity and subtlety, as indicated by ubiquitously employed terms such as “regulation,” “coordination”, “control”, “integration,” “plasticity,” “contextuality,” and many others, is almost the whole point of the new discoveries. Except that the regulation can no longer be conceived as issuing from some master controlling molecules such as DNA; rather, it is a function of the organism as a whole, working always in a direction from context to subcontext, from whole to part.

The collapse of the gene-centered model for understanding the organism — the loss of the gene as First Cause and Unmoved Mover — is a truly revolutionary shift in the foundations of biology. The growing (if still not fully welcome) sense among researchers that fundamental changes are afoot results in an occasional remark like this one by molecular biologist Toby Gibson in Trends in Biochemical Sciences:

There is no dictator in cell regulation, no first among equals, no master regulator, no top-down system of governance. The time has come to acknowledge that the cell is anarcho-syndicalist . . .

I don’t know about “anarcho-syndicalist.” What I do know is that the cell manages to live in harmony with itself and with the larger organismic context. Discovering how to think about this harmony of the whole organism without appealing to some sort of master blueprint or instruction book will be the challenge biologists face as the full implications of the epigenetic revolution come into clearer focus.

References

For references to sections I and III above, please see Part 4 of “On Making the Genome Whole,” available at http://bwo.life/mqual.  For references to section II, see Part 1 of the same series.